Save complete web page (incl css, images) using python/selenium

I am using Python/Selenium to submit genetic sequences to an online database, and want to save the full page of results I get back. Below is the code that gets me to the results I want:

from selenium import webdriver

URL = 'https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastx&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome'
SEQUENCE = 'CCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACA' #'GAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGA'
CHROME_WEBDRIVER_LOCATION = '/home/max/Downloads/chromedriver' # update this for your machine

# open page with selenium
# (first need to download Chrome webdriver, or a firefox webdriver, etc)
driver = webdriver.Chrome(executable_path=CHROME_WEBDRIVER_LOCATION)
driver.get(URL)
time.sleep(5)

# enter sequence into the query field and hit 'blast' button to search
seq_query_field = driver.find_element_by_id("seq")
seq_query_field.send_keys(SEQUENCE)

blast_button = driver.find_element_by_id("b1")
blast_button.click()
time.sleep(60)

At that point I have a page that I can manually click "save as," and get a local file (with a corresponding folder of image/js assets) that lets me view the whole returned page locally (minus content which is generated dynamically from scrolling down the page, which is fine). I assumed there would be a simple way to mimic this 'save as' function in python/selenium but haven't found one. The code to save the page below just saves html, and does not leave me with a local file that looks like it does in the web browser, with images, etc.

content = driver.page_source
with open('webpage.html', 'w') as f:
    f.write(content)

I've also found this question/answer on SO, but the accepted answer just brings up the 'save as' box, and does not provide a way to click it (as two commenters point out)

Is there a simple way to 'save [full page] as' using python? Ideally I'd prefer an answer using selenium since selenium makes the crawling part so straightforward, but I'm open to using another library if there's a better tool for this job. Or maybe I just need to specify all of the images/tables I want to download in code, and there is no shortcut to emulating the right-click 'save as' functionality?

from Save complete web page (incl css, images) using python/selenium